A Supplementary material
A.1 Chapter 2
Supplementary material for Chapter 2 on Australian Ticks.
A.1.1 Molecular methods for analysis of ticks
A.1.1.1 DNA extraction
Once ticks were identified they were surface-sterilised by washing in 10 % hypochlorite solution, rinsed in 70 % ethanol and DNA-free PBS, and then air-dried. Genomic DNA was extracted from whole or halved specimens using the DNeasy Blood and Tissue kit (QIAGEN, Germany) for adults or the QIAamp DNA Mini Kit (QIAGEN, Germany) for nymphs and larvae. Due to the large number of larvae collected from some animals and the expected low DNA yeild, in comes cases up to 5 larvae were pooled based on host, species and engorgement status. Ticks were placed in a 2 mL safe lock Eppendorf tube with a 5mm steel bead, frozen in liquid nitrogen for 1 min and homogenised by shaking at 40 Hz in a Tissue Lyser LT (QIAGEN, Germany). Final elution of DNA was adjusted according to tick size, between 30-150 \(\mu\)L of AE buffer was added to the silcon membrane. Extraction controls (EXBs) consisting of 200 \(\mu\)L sterile DNA free PBS, were included randomly in each extraction batch.
Prior to DNA extraction ticks were washed in 10% bleach solution, followed by 80% ethanol and rinsed in sterile-DNA free PBS. For museum specimens ticks were extracted in a separate dedicated laboratory, away from modern DNA. Ticks were soaked in sterile 1X PBS solution for 24-48 hours to remove ethanol from specimens. For museum and reference samples non-destructive sampling was performed, where ticks were punctured using a sterile pin and soaked in proteinase K and lysis buffer overnight (16-18 hours) at 56\(^\circ\)C, 700 rpm. DNA was then extracted using QIAamp DNA mini kit (Qiagen, Germany) following manusctures recommendations, except for final elution which was reduced to 30 \(\mu\)L of buffer AE and incubated for 30 mins, before final centrifugation. In the case of modern specimens adults ticks were bisected and half was placed in proteinase K and lysis buffer overnight (16-18 hours) at 56\(^\circ\)C, 700 rpm, the other half was retained as a voucher and placed back into 90% ethanol. The supernatant was then used for subsequent extraction using DNeasy Blood and Tissue kit (Qiagen, Germany) following manufactures recommendations. Strict laboratory hygiene was maintained throughout, equipment and surfaces were cleaned with DNAaway in between each sample.
A.1.1.2 Targeted assays and Sanger sequencing
A multilocus sequence typing (MSLT) approach was used to obtain sequence information from 3 mitochondrial genetic markers. These were; cytochrome c oxidase subunit I (COX1), 12S rRNA, 16S rRNA (primers outlined in table A.1. All reactions were carried out in 25 \(\mu\)L volumes, each containing; 1X buffer (KAPA Biosystems, South Africa), 2.5 mM MgCl2, 0.4 \(\mu\)M of primer, 200 mM of each dNTP, 1.0 U of Taq (KAPA Biosystems, South Africa), and between 1\(\mu\)L (modern specimens) 5 \(\mu\)L (museum specimens) of gDNA was added. MLST assays on museum DNA were performed in a separate dedicated facility away from modern DNA.
The COX1 gene was amplified using a hemi-nested assay with primers HCO2064/HCO1215 in the primary assay and HCO2064/HCO1240 from Song et al. (2011). Despite repeated attempts for many specimens of Amblyomma amplification using a single round PCR was not successful. Previous research has demonstrated the primer pair HCO2064/HCO1240 is successful at amplifying COX1 gene from tick specimens of the genera Ixodes, Haemaphysalis and Rhipicephalus (Evans et al. 2019). However this assay did not achieve reliable repeatable results for Am. triguttatum, therefore a hemi-nested PCR assay was used. Reactions were carried out in 25\(\mu\)L reactions, each containing; 1X buffer (KAPA Biosystems, South Africa), 2.5 mM MgCl2, 0.4\(\mu\)M of each primer (HCO2064/HCO1215 and HCO2064/HCO1240), 0.25 mM of each dNTP, 1 U of Taq (KAPA Biosystems, South Africa) and 1\(\mu\)L of either tick DNA or primary product. Thermal cycling conditions for both assays were as followed: 95\(^\circ\)C for 2 mins, followed by 35 (modern specimens) or 50 (museum specimens) cycles of 95\(^\circ\)C for 30 secs, 48\(^\circ\)C for 30 secs, 72\(^\circ\)C for 50 secs, and a final extension of 72\(^\circ\)C for 2 mins.
A 450 bp product of the mitochondrial 16S rRNA gene was amplified (Lv, Wu, Zhang, Zhang, et al. 2014). Reactions were carried out in 25\(\mu\)L reactions each containing: 1X buffer (KAPA Biosystems, South Africa), 2.5mM MgCl2, 0.4\(\mu\)M of each primer (16S-F/16S-R1), 0.25 mM of each dNTP, 1 U of Taq (KAPA Biosystems, South Africa) and 1\(\mu\)L of tick gDNA. A touchdown approach was used for the 16S rRNA assays were as followed; 95\(^\circ\)C for 5 mins, followed by 5 cycles of 95\(^\circ\)C for 30 secs, 49\(^\circ\)C for 30 secs, 68\(^\circ\)C for 30 secs; 5 cycles of 95\(^\circ\)C for 30 secs, 47\(^\circ\)C for 30 secs, 68\(^\circ\)C for 30 secs; 5 cycles of 95\(^\circ\)C for 30 secs, 45\(^\circ\)C for 30 secs, 68\(^\circ\)C for 30 secs; 25 cycles of 95\(^\circ\)C for 30 secs, 43\(^\circ\)C for 30 secs, 68\(^\circ\)C for 30 secs; and a final extension of 68\(^\circ\)C for 5 mins.
A 370bp product of the mitochondrial 12S rRNA gene was amplified. Reactions were carried out in 25\(\mu\)L reactions each containing: 1X buffer (KAPA Biosystems, South Africa), 2.5mM MgCl2, 0.4\(\mu\)M of each primer (T1B/T2A), 0.25mM of each dNTP, 1 U of Taq (KAPA Biosystems, South Africa) and 1\(\mu\)L of tick gDNA.Thermal cycling conditions were as followed; 95\(^\circ\)C for 5 mins, followed by 5 cycles of 95\(^\circ\)C for 15 secs, 51\(^\circ\)C for 30 secs, 68\(^\circ\)C for 30 secs; 25 cycles of 95\(^\circ\)C for 30 secs, 53\(^\circ\)C for 30 secs, 72\(^\circ\)C for 1 min; and a final extension of 72\(^\circ\)C for 5 mins.
Amplified products were visualised on a 1% agarose gel stained with SYBR Safe (Invitrogen, USA) and bands of the correct size were excised using a sterile scalpel blade and purified using previously described methods (R. Yang et al. 2013). Sanger sequencing was carried out in both directions and sequencing was performed at the Australian Genome Research Facility (Perth, Western Australia) on an Applied Biosystems 3730xl DNA Analyzer using BigDye(TM) Terminator v3.1 Cycle Sequencing Kit.
| Primer | Sequence (5’-3’) | Reference |
|---|---|---|
| Cytochrome c oxidase subunit 1 | ||
| HCO2064 | GGTGGGCTCATACAATAAATCC | 1 |
| HCO1215 | GCCATTTTACCGCGATGA | 1 |
| HCO1240 | CCACAAATCATAAAGACATTGG | 1 |
| 12S rDNA | ||
| T2A | AAACTAGGATTAGATACCCT | 2 |
| T1B | AATGAGAGCGACGGGCGATGT | 2 |
| 16S rDNA | ||
| 16S-F | TTAAATTGCTGTRGTATT | 3 |
| 16S-R1 | CCGGTCTGAACTCASAWC | 3 |
| Illumina MiSeq adapters | ||
| Forward overhand | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG | Illumina |
| Reverse overhand | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG |
A.1.1.3 Library prepation and amplicon next-generation sequencing
Based on results from the MLST approached used above a a high-throughput metabarcoding approach was developed to identify tick species. In addition the short fragment size (~370 bp) and ability to deliminate between species made the 12rDNA loci most suitable for transferring onto the Illumina MiSeq. The pan-Ixodida primers T1B and T2A (Beati and Keirans 2001) were ordered with Illumina MiSeq adapter overhangs. Amplicon PCRs were carried out in 25 \(\mu\)L reactions each containing: 1X buffer (KAPA Biosystems, South Africa), 2.5 mM MgCl2, 0.4 \(\mu\)M of each primer, 0.25 mM of each dNTP, 1 U of Taq (KAPA Biosystems, South Africa) and 1 \(\mu\)L of tick gDNA.Thermal cycling conditions were as followed; 95\(^\circ\)C for 5 mins, followed by 5 cycles of 95\(^\circ\)C for 15 secs, 51\(^\circ\)C for 30 secs, 68\(^\circ\)C for 30 secs; 25 cycles of 95\(^\circ\)C for 30 secs, 53\(^\circ\)C for 30 secs, 72\(^\circ\)C for 1 min; and a final extension of 72\(^\circ\)C for 5 mins.
Amplicon PCR products were then indexed using the Nextera XT DNA library preparation kit in 25 \(\mu\)L volumes following manufacturer’s recommendations. All PCRs included no template controls (NTC) during each reaction set up and PCRs were performed under strict laboratory conditions. Amplicons were then dual-indexed using the Nextera XT index kit. Reactions were performed in 25 \(\mu\)L volumes using following manufacturers recommendations. Libraries were purified with Axygen PCR clean up beads, pooled in equimolar amounts and quantified using Qubit High Sensitivity dsDNA assay kit (Thermo Fisher Scientific, Waltham, MA, USA) and amplicons were pooled in equimolar amounts. Libraries were shipped to Australian Genomic Research Facility (Melbourne, Australia) for final QC and sequenced on the Illumina MiSeq using v2 chemistry (2 x 250 paired end).
A.1.1.4 Bioinformatics
Multilocus sequence typing data produced by Sanger Sequencing
Sequences were imported into Geneious 10.2.6 (https://www.geneious.com) for quality inspection. Forward and reverse sequenced were aligned using the default parameters in Geneious and primers were trimmed. Reference sequences were retrieved from GenBank (Benson et al. 2017) and aligned with sequences obtained in the present study using MUSCLE (R. C. Edgar 2004).
High-throughout sequence data produced by Illumina MiSeq
Illumina MiSeq fastq data was analysed using bioinformatic pipeline with the program USEARCH v11 (R. C. Edgar 2010). Paired end reads were merged and sequences matching forward and reverse primers were retrieved (max number of mismatches = 2). Sequences were then quality filtered and singletons were removed. The unoise3 (Robert C. Edgar 2016) algorithm was used to perform denoising (error-correction) and generate zero-radius taxonomic units (zOTUs) equivalent to amplicon sequence variants (ASVs). Resulting zOTUs were subject to BLAST analysis (BLASTN 2.11.0+ (Zhang et al. 2000; Morgulis et al. 2008)) against NCBI nucleotide collection (nt) database. Taxonomic lineage for each top hit (based on e-value score) was retrieved from NCBI taxonomy database using TaxonKit (Weiss et al. 2021). Final taxonomy assignment was then refined to lowest common ancestor based on BLAST results (percentage identity, e-value and query coverage) and sequence alignment method.
Sequences generated were aligned with reference sequences were retrieved from GenBank (Benson et al. 2017) using MAFFT (R. C. Edgar 2004). Phylogenies were inferred using the maximum likelihood (ML) method. The optimal evolutionary model was selected using ModelFinder (Kalyaanamoorthy et al. 2017) based on bayesian information criterion. Phylogenetic analysis was performed in IQ-TREE v1.6.11 (Nguyen et al. 2015) and bootstrap support was calculated using ultrafast (UFBoot2) method with 10,000 replicates (Hoang et al. 2018). Genetic sequence similarity was calculated using the Kimura Two-Parameter method (Tamura and Nei 1993).
Figure A.1: Occurrence map of ticks (Acari: Ixodida) records sourced from the Atlas of Living Australia (www.ala.org.au), data has not been curated.
| Target gene | Organism | Isolate | Host | Country | Note | Development stage | Genbank |
|---|---|---|---|---|---|---|---|
| COX1 | Bothriocroton tachyglossi | ACF1 | Short-beaked echidna | Australia: Queensland | PI1268 | Female | OM840098 |
| COX1 | Bothriocroton tachyglossi | ACF3 | Short-beaked echidna | Australia: Queensland | PI1268 | Female | OM840099 |
| COX1 | Ixodes ornithorhynchi | IOF3 | Platypus | Australia: Queensland | PI419 | Female | OM840100 |
| COX1 | Ixodes ornithorhynchi | IOF4 | Platypus | Australia: Queensland | PI419 | Female | OM840101 |
| COX1 | Ixodes ornithorhynchi | IOF5 | Platypus | Australia: Queensland | PI419 | Female | OM840102 |
| COX1 | Bothriocroton auruginans | BAF5 | Common wombat | Australia: Victoria | PI1382 | Female | OM840103 |
| COX1 | Bothriocroton auruginans | BAF6 | Common wombat | Australia: Victoria | PI1382 | Female | OM840104 |
| COX1 | Haemaphysalis humerosa | HHM1 | Northern brown bandicoot | Australia: Northern Territory | PI797 | Male | OM840105 |
| COX1 | Ixodes tasmani | ITF6 | Eastern barred bandicoot | Australia: Tasmania | PI321 | Female | OM840106 |
| COX1 | Ixodes tasmani | ITF10 | Eastern barred bandicoot | Australia: Tasmania | PI321 | Female | OM840107 |
| COX1 | Ixodes tasmani | ITN6 | Eastern barred bandicoot | Australia: Tasmania | PI321 | Nymph | OM840108 |
| COX1 | Ixodes holocyclus | B1 | Long-nosed bandicoot | Australia: New South Wales | PI387 | Female | OM840109 |
| COX1 | Ixodes holocyclus | B2 | Long-nosed bandicoot | Australia: New South Wales | PI1592 | Female | OM840110 |
| COX1 | Ixodes tasmani | B8 | Long-nosed bandicoot | Australia: New South Wales | PI1132 | Nymph | OM840111 |
| COX1 | Ixodes tasmani | B16 | Bandicoot sp. | Australia: Tasmania | PI319 | Female | OM840112 |
| COX1 | Ixodes holocyclus | B57 | Long-nosed bandicoot | Australia: New South Wales | PI1129 | Nymph | OM840113 |
| COX1 | Ixodes tasmani | B62 | Long-nosed bandicoot | Australia: Queensland | PI1260 | Nymph | OM840114 |
| COX1 | Ixodes tasmani | B63 | Long-nosed bandicoot | Australia: Queensland | PI1260 | Nymph | OM840115 |
| COX1 | Ixodes tasmani | B64 | Long-nosed bandicoot | Australia: Queensland | PI1260 | Nymph | OM840116 |
| COX1 | Haemaphysalis bancrofti | B77 | Long-nosed bandicoot | Australia: New South Wales | PI1388 | Female | OM840117 |
| COX1 | Ixodes tasmani | B87 | Eastern barred bandicoot | Australia: Tasmania | PI321 | Female | OM840118 |
| COX1 | Ixodes tasmani | B88 | Eastern barred bandicoot | Australia: Tasmania | PI321 | Female | OM840119 |
| COX1 | Ixodes tasmani | B89 | Eastern barred bandicoot | Australia: Tasmania | PI321 | Female | OM840120 |
| COX1 | Haemaphysalis bancrofti | B110 | Long-nosed bandicoot | Australia: New South Wales | PI771 | Nymph | OM840121 |
| COX1 | Ixodes tasmani | TD1 | Tasmanian Devil | Australia: Tasmania | PI2105 | Nymph | OM840122 |
| COX1 | Ixodes tasmani | TD2 | Tasmanian Devil | Australia: Tasmania | PI2105 | Nymph | OM840123 |
| COX1 | Ixodes tasmani | TD3 | Tasmanian Devil | Australia: Tasmania | PI2105 | Nymph | OM840124 |
| COX1 | Ixodes tasmani | TD5 | Tasmanian Devil | Australia: Tasmania | PI2105 | Female | OM840125 |
| COX1 | Ixodes tasmani | TD6 | Tasmanian Devil | Australia: Tasmania | PI2106 | Nymph | OM840126 |
| COX1 | Ixodes tasmani | TD7 | Tasmanian Devil | Australia: Tasmania | PI2107 | Female | OM840127 |
| COX1 | Ixodes tasmani | TD8 | Tasmanian Devil | Australia: Tasmania | PI2108 | Female | OM840128 |
| COX1 | Ixodes tasmani | TD9 | Tasmanian Devil | Australia: Tasmania | PI2109 | Female | OM840129 |
| COX1 | Ixodes tasmani | TD10 | Tasmanian Devil | Australia: Tasmania | PI2110 | Female | OM840130 |
| COX1 | Ixodes fecialis | TD12 | Tasmanian Devil | Australia: Tasmania | PI2112 | Female | OM840131 |
| COX1 | Ixodes fecialis | TD13 | Tasmanian Devil | Australia: Tasmania | PI2113 | Nymph | OM840132 |
| COX1 | Ixodes fecialis | TD14 | Tasmanian Devil | Australia: Tasmania | PI2114 | Female | OM840133 |
| COX1 | Ixodes tasmani | TD15 | Tasmanian Devil | Australia: Tasmania | PI2115 | Female | OM840134 |
| COX1 | Amblyomma triguttatum | AT2F | Questing | Australia: Yanchep, Western Australia | Female | MN106717 | |
| COX1 | Amblyomma triguttatum | AT3M | Questing | Australia: Yanchep, Western Australia | Male | MN106719 | |
| COX1 | Amblyomma triguttatum | AT4M | Questing | Australia: Yanchep, Western Australia | Male | MN106718 | |
| COX1 | Bothriocroton auruginans | BA1F | Common wombat | Australia: Trafalgar, Victoria | Female | MN106720 | |
| COX1 | Bothriocroton auruginans | BA2F | Common wombat | Australia: Trafalgar, Victoria | Female | MN106721 | |
| COX1 | Haemaphysalis bancrofti | HB2F | Long-nosed bandicoot | Australia: Stony Chute, New South Wales | Female | MN106722 | |
| COX1 | Haemaphysalis bancrofti | HB3N | Long-nosed bandicoot | Australia: Stony Chute, New South Wales | Nymph | MN106723 | |
| COX1 | Haemaphysalis humerosa | HH1N | Northern brown bandicoot | Australia: Beerwah, Queensland | Nymph | MN106726 | |
| COX1 | Haemaphysalis humerosa | HH3M | Northern brown bandicoot | Australia: Palmerston, Northern Territory | Male | MN106724 | |
| COX1 | Haemaphysalis humerosa | HH4M | Northern brown bandicoot | Australia: Palmerston, Northern Territory | Male | MN106725 | |
| COX1 | Ixodes cornuatus | IC1F | Dog | Australia: Port Sorrell, Tasmania | Female | MN106727 | |
| COX1 | Ixodes hirsti | IHi1F | Cat | Australia: Port Sorrell, Tasmania | Female | MN106728 | |
| COX1 | Ixodes holocyclus | Q92 | Questing | Australia: Springbrook, Queensland | Female | MN106729 | |
| COX1 | Ixodes holocyclus | Q93 | Questing | Australia: Springbrook, Queensland | Male | MN106730 | |
| COX1 | Ixodes tasmani | C4IT | Tasmanian Devil | Australia: Tasmania | Female | MN106731 | |
| COX1 | Ixodes tasmani | WL1 | Eastern ringtail possum | Australia: Queensland | OM791407 | ||
| COX1 | Ixodes tasmani | WL2 | Koala | Australia: Queensland | OM791408 | ||
| COX1 | Haemaphysalis bancrofti | WL11 | Eastern grey kangaroo | Australia: Queensland | OM791409 | ||
| COX1 | Bothriocroton undatum | WL18 | Lace Monitor | Australia: Queensland | OM791410 | ||
| COX1 | Bothriocroton tachyglossi | WL19 | Lace Monitor | Australia: Queensland | OM791411 | ||
| COX1 | Bothriocroton undatum | WL20 | Lace Monitor | Australia: Queensland | OM791412 | ||
| COX1 | Bothriocroton tachyglossi | WL30 | Short-beaked echidna | Australia: Queensland | OM791413 | ||
| COX1 | Bothriocroton tachyglossi | WL31 | Short-beaked echidna | Australia: Queensland | OM791414 | ||
| COX1 | Bothriocroton tachyglossi | WL32 | Short-beaked echidna | Australia: Queensland | OM791415 | ||
| COX1 | Bothriocroton tachyglossi | WL33 | Short-beaked echidna | Australia: Queensland | OM791416 | ||
| COX1 | Bothriocroton tachyglossi | WL34 | Short-beaked echidna | Australia: Queensland | OM791417 | ||
| COX1 | Bothriocroton tachyglossi | WL35 | Short-beaked echidna | Australia: Queensland | OM791418 | ||
| COX1 | Bothriocroton tachyglossi | WL36 | Short-beaked echidna | Australia: Queensland | OM791419 | ||
| COX1 | Bothriocroton tachyglossi | WL37 | Short-beaked echidna | Australia: Queensland | OM791420 | ||
| COX1 | Bothriocroton tachyglossi | WL38 | Short-beaked echidna | Australia: Queensland | OM791421 | ||
| COX1 | Bothriocroton tachyglossi | WL39 | Short-beaked echidna | Australia: Queensland | OM791422 | ||
| COX1 | Bothriocroton tachyglossi | WL40 | Short-beaked echidna | Australia: Queensland | OM791423 | ||
| COX1 | Bothriocroton tachyglossi | WL41 | Short-beaked echidna | Australia: Queensland | OM791424 | ||
| COX1 | Bothriocroton tachyglossi | WL42 | Short-beaked echidna | Australia: Queensland | OM791425 | ||
| COX1 | Bothriocroton tachyglossi | WL44 | Short-beaked echidna | Australia: Queensland | OM791426 | ||
| COX1 | Bothriocroton tachyglossi | WL45 | Short-beaked echidna | Australia: Queensland | OM791427 | ||
| COX1 | Bothriocroton tachyglossi | WL46 | Short-beaked echidna | Australia: Queensland | OM791428 | ||
| COX1 | Amblyomma fimbriatum | WL51 | Lace Monitor | Australia: Queensland | OM791429 | ||
| COX1 | Amblyomma fimbriatum | WL52 | Lace Monitor | Australia: Queensland | OM791430 | ||
| COX1 | Bothriocroton undatum | WL53 | Lace Monitor | Australia: Queensland | OM791431 | ||
| COX1 | Bothriocroton undatum | WL54 | Lace Monitor | Australia: Queensland | OM791432 | ||
| COX1 | Bothriocroton undatum | WL55 | Lace Monitor | Australia: Queensland | OM791433 | ||
| COX1 | Amblyomma fimbriatum | WL56 | Lace Monitor | Australia: Queensland | OM791434 | ||
| COX1 | Bothriocroton undatum | WL57 | Lace Monitor | Australia: Queensland | OM791435 | ||
| COX1 | Bothriocroton undatum | WL58 | Lace Monitor | Australia: Queensland | OM791436 | ||
| COX1 | Bothriocroton undatum | WL60 | Lace Monitor | Australia: Queensland | OM791437 | ||
| 16S rRNA | Amblyomma triguttatum | AT1F | Questing | Australia: Yanchep, Western Australia | OM830384 | ||
| 16S rRNA | Amblyomma triguttatum | AT2F | Questing | Australia: Yanchep, Western Australia | OM830385 | ||
| 16S rRNA | Amblyomma triguttatum | AT3M | Questing | Australia: Yanchep, Western Australia | OM830386 | ||
| 16S rRNA | Amblyomma triguttatum | AT4M | Questing | Australia: Yanchep, Western Australia | OM830387 | ||
| 16S rRNA | Amblyomma triguttatum | AT5N | Questing | Australia: Yanchep, Western Australia | OM830388 | ||
| 16S rRNA | Bothriocroton auruginans | BA1F | Common wombat | Australia: Trafalgar, Victoria | OM830389 | ||
| 16S rRNA | Bothriocroton auruginans | BA2F | Common wombat | Australia: Trafalgar, Victoria | OM830390 | ||
| 16S rRNA | Haemaphysalis bancrofti | HB2F | Long-nosed bandicoot | Australia: Stony Chute, New South Wales | OM830391 | ||
| 16S rRNA | Haemaphysalis bancrofti | HB3F | Long-nosed bandicoot | Australia: Stony Chute, New South Wales | OM830392 | ||
| 16S rRNA | Haemaphysalis humerosa | HH1M | Northern brown bandicoot | Australia: Beerwah, Queensland | OM830393 | ||
| 16S rRNA | Haemaphysalis humerosa | HH3M | Northern brown bandicoot | Australia: Palmerston, Northern Territory | OM830394 | ||
| 16S rRNA | Haemaphysalis humerosa | HH4M | Northern brown bandicoot | Australia: Palmerston, Northern Territory | OM830395 | ||
| 16S rRNA | Ixodes cornuatus | IC1F | Dog | Australia: Port Sorrell, Tasmania | OM830396 | ||
| 16S rRNA | Ixodes hirsti | IHi1F | Cat | Australia: Port Sorrell, Tasmania | OM830397 | ||
| 16S rRNA | Ixodes holocyclus | IH1F | Long-nosed bandicoot | Australia: New South Wales | OM830398 | ||
| 16S rRNA | Ixodes holocyclus | Q92 | Questing | Australia: Springbrook, Queensland | OM830399 | ||
| 16S rRNA | Ixodes holocyclus | Q93 | Questing | Australia: Springbrook, Queensland | OM830400 | ||
| 16S rRNA | Ixodes tasmani | IT3 | Tasmanian Devil | Australia: Tasmania | OM830401 | ||
| 16S rRNA | Ixodes tasmani | WL1 | Eastern ringtail possum | Australia: Queensland | OM830402 | ||
| 16S rRNA | Ixodes tasmani | WL2 | Koala | Australia: Queensland | OM830403 | ||
| 16S rRNA | Haemaphysalis bancrofti | WL11 | Eastern grey kangaroo | Australia: Queensland | OM830404 | ||
| 16S rRNA | Bothriocroton tachyglossi | WL19 | Lace Monitor | Australia: Queensland | OM830405 | ||
| 16S rRNA | Bothriocroton undatum | WL20 | Lace Monitor | Australia: Queensland | OM830406 | ||
| 16S rRNA | Bothriocroton tachyglossi | WL30 | Short-beaked echidna | Australia: Queensland | OM830407 | ||
| 16S rRNA | Bothriocroton tachyglossi | WL31 | Short-beaked echidna | Australia: Queensland | OM830408 | ||
| 16S rRNA | Bothriocroton tachyglossi | WL32 | Short-beaked echidna | Australia: Queensland | OM830409 | ||
| 16S rRNA | Bothriocroton tachyglossi | WL33 | Short-beaked echidna | Australia: Queensland | OM830410 | ||
| 16S rRNA | Bothriocroton tachyglossi | WL34 | Short-beaked echidna | Australia: Queensland | OM830411 | ||
| 16S rRNA | Bothriocroton tachyglossi | WL35 | Short-beaked echidna | Australia: Queensland | OM830412 | ||
| 16S rRNA | Bothriocroton tachyglossi | WL36 | Short-beaked echidna | Australia: Queensland | OM830413 | ||
| 16S rRNA | Bothriocroton tachyglossi | WL37 | Short-beaked echidna | Australia: Queensland | OM830414 | ||
| 16S rRNA | Bothriocroton tachyglossi | WL38 | Short-beaked echidna | Australia: Queensland | OM830415 | ||
| 16S rRNA | Bothriocroton tachyglossi | WL39 | Short-beaked echidna | Australia: Queensland | OM830416 | ||
| 16S rRNA | Bothriocroton tachyglossi | WL41 | Short-beaked echidna | Australia: Queensland | OM830417 | ||
| 16S rRNA | Bothriocroton tachyglossi | WL42 | Short-beaked echidna | Australia: Queensland | OM830418 | ||
| 16S rRNA | Bothriocroton tachyglossi | WL44 | Short-beaked echidna | Australia: Queensland | OM830419 | ||
| 16S rRNA | Bothriocroton tachyglossi | WL45 | Short-beaked echidna | Australia: Queensland | OM830420 | ||
| 16S rRNA | Bothriocroton tachyglossi | WL46 | Short-beaked echidna | Australia: Queensland | OM830421 | ||
| 16S rRNA | Amblyomma fimbriatum | WL51 | Lace Monitor | Australia: Queensland | OM830422 | ||
| 16S rRNA | Amblyomma fimbriatum | WL52 | Lace Monitor | Australia: Queensland | OM830423 | ||
| 16S rRNA | Bothriocroton undatum | WL53 | Lace Monitor | Australia: Queensland | OM830424 | ||
| 16S rRNA | Bothriocroton undatum | WL54 | Lace Monitor | Australia: Queensland | OM830425 | ||
| 16S rRNA | Bothriocroton undatum | WL55 | Lace Monitor | Australia: Queensland | OM830426 | ||
| 16S rRNA | Amblyomma fimbriatum | WL56 | Lace Monitor | Australia: Queensland | OM830427 | ||
| 16S rRNA | Bothriocroton undatum | WL57 | Lace Monitor | Australia: Queensland | OM830428 | ||
| 16S rRNA | Bothriocroton undatum | WL58 | Lace Monitor | Australia: Queensland | OM830429 | ||
| 12S rRNA | Amblyomma triguttatum | AT1F | Questing | Australia: Yanchep, Western Australia | OM830716 | ||
| 12S rRNA | Amblyomma triguttatum | AT2F | Questing | Australia: Yanchep, Western Australia | OM830717 | ||
| 12S rRNA | Amblyomma triguttatum | AT3M | Questing | Australia: Yanchep, Western Australia | OM830718 | ||
| 12S rRNA | Amblyomma triguttatum | AT4M | Questing | Australia: Yanchep, Western Australia | OM830719 | ||
| 12S rRNA | Amblyomma triguttatum | AT5N | Questing | Australia: Yanchep, Western Australia | OM830720 | ||
| 12S rRNA | Bothriocroton auruginans | BA1F | Common wombat | Australia: Trafalgar, Victoria | OM830721 | ||
| 12S rRNA | Bothriocroton auruginans | BA2F | Common wombat | Australia: Trafalgar, Victoria | OM830722 | ||
| 12S rRNA | Haemaphysalis bancrofti | HB2F | Long-nosed bandicoot | Australia: Stony Chute, New South Wales | OM830723 | ||
| 12S rRNA | Haemaphysalis bancrofti | HB3F | Long-nosed bandicoot | Australia: Stony Chute, New South Wales | OM830724 | ||
| 12S rRNA | Haemaphysalis humerosa | HH1M | Northern brown bandicoot | Australia: Beerwah, Queensland | OM830725 | ||
| 12S rRNA | Haemaphysalis humerosa | HH3M | Northern brown bandicoot | Australia: Palmerston, Northern Territory | OM830726 | ||
| 12S rRNA | Haemaphysalis humerosa | HH4M | Northern brown bandicoot | Australia: Palmerston, Northern Territory | OM830727 | ||
| 12S rRNA | Ixodes cornuatus | IC1F | Dog | Australia: Port Sorrell, Tasmania | OM830728 | ||
| 12S rRNA | Ixodes hirsti | IHi1F | Cat | Australia: Port Sorrell, Tasmania | OM830729 | ||
| 12S rRNA | Ixodes holocyclus | IH1F | Long-nosed bandicoot | Australia: New South Wales | OM830730 | ||
| 12S rRNA | Ixodes holocyclus | Q92 | Questing | Australia: Springbrook, Queensland | OM830731 | ||
| 12S rRNA | Ixodes holocyclus | Q93 | Questing | Australia: Springbrook, Queensland | OM830732 | ||
| 12S rRNA | Ixodes tasmani | IT3 | Tasmanian Devil | Australia: Tasmania | OM830733 | ||
| 12S rRNA | Ixodes tasmani | WL1 | Eastern ringtail possum | Australia: Queensland | OM830734 | ||
| 12S rRNA | Ixodes tasmani | WL2 | Koala | Australia: Queensland | OM830735 | ||
| 12S rRNA | Haemaphysalis bancrofti | WL11 | Eastern grey kangaroo | Australia: Queensland | OM830736 | ||
| 12S rRNA | Bothriocroton undatum | WL18 | Lace Monitor | Australia: Queensland | OM830737 | ||
| 12S rRNA | Bothriocroton tachyglossi | WL19 | Lace Monitor | Australia: Queensland | OM830738 | ||
| 12S rRNA | Bothriocroton undatum | WL20 | Lace Monitor | Australia: Queensland | OM830739 | ||
| 12S rRNA | Bothriocroton tachyglossi | WL30 | Short-beaked echidna | Australia: Queensland | OM830740 | ||
| 12S rRNA | Bothriocroton tachyglossi | WL31 | Short-beaked echidna | Australia: Queensland | OM830741 | ||
| 12S rRNA | Bothriocroton tachyglossi | WL32 | Short-beaked echidna | Australia: Queensland | OM830742 | ||
| 12S rRNA | Bothriocroton tachyglossi | WL33 | Short-beaked echidna | Australia: Queensland | OM830743 | ||
| 12S rRNA | Bothriocroton tachyglossi | WL34 | Short-beaked echidna | Australia: Queensland | OM830744 | ||
| 12S rRNA | Bothriocroton tachyglossi | WL35 | Short-beaked echidna | Australia: Queensland | OM830745 | ||
| 12S rRNA | Bothriocroton tachyglossi | WL36 | Short-beaked echidna | Australia: Queensland | OM830746 | ||
| 12S rRNA | Bothriocroton tachyglossi | WL37 | Short-beaked echidna | Australia: Queensland | OM830747 | ||
| 12S rRNA | Bothriocroton tachyglossi | WL38 | Short-beaked echidna | Australia: Queensland | OM830748 | ||
| 12S rRNA | Bothriocroton tachyglossi | WL39 | Short-beaked echidna | Australia: Queensland | OM830749 | ||
| 12S rRNA | Bothriocroton tachyglossi | WL40 | Short-beaked echidna | Australia: Queensland | OM830750 | ||
| 12S rRNA | Bothriocroton tachyglossi | WL41 | Short-beaked echidna | Australia: Queensland | OM830751 | ||
| 12S rRNA | Bothriocroton tachyglossi | WL42 | Short-beaked echidna | Australia: Queensland | OM830752 | ||
| 12S rRNA | Bothriocroton tachyglossi | WL44 | Short-beaked echidna | Australia: Queensland | OM830753 | ||
| 12S rRNA | Bothriocroton tachyglossi | WL45 | Short-beaked echidna | Australia: Queensland | OM830754 | ||
| 12S rRNA | Bothriocroton tachyglossi | WL46 | Short-beaked echidna | Australia: Queensland | OM830755 | ||
| 12S rRNA | Amblyomma fimbriatum | WL51 | Lace Monitor | Australia: Queensland | OM830756 | ||
| 12S rRNA | Amblyomma fimbriatum | WL52 | Lace Monitor | Australia: Queensland | OM830757 | ||
| 12S rRNA | Bothriocroton undatum | WL53 | Lace Monitor | Australia: Queensland | OM830758 | ||
| 12S rRNA | Bothriocroton undatum | WL54 | Lace Monitor | Australia: Queensland | OM830759 | ||
| 12S rRNA | Bothriocroton undatum | WL55 | Lace Monitor | Australia: Queensland | OM830760 | ||
| 12S rRNA | Amblyomma fimbriatum | WL56 | Lace Monitor | Australia: Queensland | OM830761 | ||
| 12S rRNA | Bothriocroton undatum | WL57 | Lace Monitor | Australia: Queensland | OM830762 | ||
| 12S rRNA | Bothriocroton undatum | WL58 | Lace Monitor | Australia: Queensland | OM830763 | ||
| 12S rRNA | Bothriocroton undatum | WL60 | Lace Monitor | Australia: Queensland | OM830764 | ||
| 18S rRNA | Amblyomma albolimbatum | R1 | Bobtail | Australia: Western Australia | PI982 | Female | OM756762 |
| 18S rRNA | Amblyomma albolimbatum | R2 | Bobtail | Australia: Western Australia | PI982 | Male | OM756763 |
| 18S rRNA | Amblyomma albolimbatum | R21 | Bobtail | Australia: Western Australia | PI1733 | Male | OM756764 |
| 18S rRNA | Amblyomma albolimbatum | R22 | Bobtail | Australia: Western Australia | PI1732 | Male | OM756765 |
| 18S rRNA | Amblyomma fimbriatum | WL52 | Lace Monitor | Australia: Queensland | PI1732 | OM756761 | |
| 18S rRNA | Amblyomma triguttatum | ATT51 | Questing | Australia: Western Australia | ATT51 | OM756760 |
| GenBank (reference) | Species (Reference) | GenBank (new) | Species (new) |
|---|---|---|---|
| AB073725 | Ixodes persulcatus | MW665133 | Ixodes holocyclus |
| AB075955 | Ixodes holocyclus | MW665134 | Ixodes tasmani |
| AB087746 | Ixodes uriae | MW665135 | Ixodes trichosuri |
| AB113317 | Amblyomma triguttatum | MW665136 | Ixodes trichosuri |
| AF031851 | Dermacentor variabilis | MW665137 | Ixodes tasmani |
| AF031852 | Haemaphysalis humerosa | MW665138 | Ixodes tasmani |
| AF031853 | Haemaphysalis longicornis | MW665139 | Ixodes australiensis |
| AM410581 | Ixodes uriae | MW665140 | Ixodes tasmani |
| EF173724 | Bothriocroton glebopalma | MW665141 | Ixodes antechini |
| EF173725 | Bothriocroton concolor | MW665142 | Ixodes tasmani |
| EF173726 | Bothriocroton undatum | MW665143 | Amblyomma triguttatum |
| HG918113 | Ixodes scapularis | MW665144 | Ixodes antechini |
| IUU95907 | Ixodes uriae | MW665145 | Amblyomma triguttatum |
| JN863727 | Bothriocroton concolor | MW665146 | Amblyomma triguttatum |
| JN863728 | Bothriocroton undatum | MW665147 | Amblyomma triguttatum |
| JN863729 | Robertsicus elaphensis | MW665148 | Amblyomma triguttatum |
| JN863730 | Amblyomma fimbriatum | MW665149 | Amblyomma triguttatum |
| JN863731 | Archaeocroton sphenodonti | MW665150 | Ixodes trichosuri |
| JQ346679 | Haemaphysalis doenitzi | OM830716 | Amblyomma triguttatum |
| KC503255 | Rhipicephalus australis | OM830717 | Amblyomma triguttatum |
| KF197132 | Ixodes ricinus | OM830718 | Amblyomma triguttatum |
| KF583608 | Haemaphysalis longicornis | OM830719 | Amblyomma triguttatum |
| KJ000060 | Ixodes pavlovskyi | OM830720 | Amblyomma triguttatum |
| KM455964 | Ixodes simplex | OM830721 | Bothriocroton auruginans |
| MH043264 | Ixodes holocyclus | OM830722 | Bothriocroton auruginans |
| MH043265 | Ixodes holocyclus | OM830723 | Haemaphysalis bancrofti |
| MH043266 | Ixodes holocyclus | OM830724 | Haemaphysalis bancrofti |
| MH043267 | Ixodes holocyclus | OM830725 | Haemaphysalis humerosa |
| MH043268 | Haemaphysalis bancrofti | OM830726 | Haemaphysalis humerosa |
| MH043269 | Ixodes tasmani | OM830727 | Haemaphysalis humerosa |
| MH043270 | Ixodes tasmani | OM830728 | Ixodes cornuatus |
| MH043271 | Ixodes tasmani | OM830729 | Ixodes hirsti |
| NC_002010 | Ixodes hexagonus | OM830730 | Ixodes holocyclus |
| U95858 | Bothriocroton glebopalma | OM830732 | Ixodes holocyclus |
| U95860 | Bothriocroton hydrosauri | OM830733 | Ixodes tasmani |
| OM830734 | Ixodes tasmani | ||
| OM830735 | Ixodes tasmani | ||
| OM830736 | Haemaphysalis bancrofti | ||
| OM830746 | Bothriocroton tachyglossi | ||
| OM830756 | Amblyomma fimbriatum | ||
| OM830757 | Amblyomma fimbriatum | ||
| OM830761 | Amblyomma fimbriatum | ||
| OM830762 | Bothriocroton undatum |
A.2 Chapter 3
Supplementary material for Chapter 3 on the Microbiome of Ticks and Wildlife.
| Bioinformatics step | Control (totals) | Sample (totals) | Blood | Tick | Tissue |
|---|---|---|---|---|---|
| Sum input | 5534288 | 96969355 | 35160160 | 24844688 | 36964507 |
| Mean input | 85143 | 152228 | 185053 | 95556 | 197671 |
| Sum filtered | 3922421 | 70048790 | 24929182 | 19809370 | 25310238 |
| Mean filtered | 60345 | 109967 | 131206 | 76190 | 135349 |
| Filtered % | 70.90% | 72.20% | 70.90% | 79.70% | 68.50% |
| Sum denoised | 3906305 | 69477650 | 24758558 | 19753200 | 24965892 |
| Mean denoised | 60097 | 109070 | 130308 | 75974 | 133507 |
| Sum merged | 3815914 | 67183779 | 24028959 | 19127172 | 24027648 |
| Mean merged | 58706 | 105469 | 126468 | 73566 | 128490 |
| Merged % | 69.00% | 69.30% | 68.30% | 77.00% | 65.00% |
| Sum non-chimeric | 3719634 | 64186307 | 23061496 | 18368918 | 22755893 |
| Mean non-chimeric | 57225 | 100763 | 121376 | 70650 | 121689 |
| Input non-chimeric % | 67.20% | 66.20% | 65.60% | 73.90% | 61.60% |
Figure A.2: Summary of sequences obtained form bacterial metabarcoding of the 16S rRNA gene (Illumina MiSeq). (A) Library size (i.e. number of sequences) obtained from samples. (B) Prevalence of contaminant ASVs as identified by decontam analysis in controls and samples. (C) Distribution of the number of reads in sample categories blood, tick and tissue.
Figure A.3: Rarefaction curves (number of ASVs) of wildlife blood, tick and tissue samples from bacterial profiling (step size = 100). Rarefaction curves were used to determine how adequate sequencing depth was in detecting the complete theoretical suite of bacterial organisms present; of note, rarefaction plots excluded OTUs considered environmental contaminants (described methods).
Figure A.4: Boxplot of Alpha-diversity indices for tick samples. Diversity indexes (A) Observed number of ASVs, (B) Chao1 index, (C) Shannon index and (D) inverse Simpson index. Boxplots and violin plots represent the distribution of diversity among tick species. Statistical analysis between sample types calculated using Wilcoxon pairwise (non-parametric) test. Pools of different tick species excluded from analysis.
Figure A.5: Phylum level distribution plots of bacterial composition in wildlife samples.
Figure A.6: Abundance (no. of sequences) and prevalence in samples of bacterial phyla identified from wildlife samples (A) overall, (B) blood, (C) tick and (D) tissue.
Figure A.7: Bacterial family taxa (top 6 most abundant) identified in wildlife blood samples.
Figure A.8: Bacterial family taxa (top 6 most abundant) identified in wildlife tick samples.
Figure A.9: Bacterial family taxa (top 6 most abundant) identified in wildlife tissue samples.
Figure A.10: Hierarchical cluster analysis of bacterial communities from wildlife samples. Data points coloured by sample type; blood, tick and tissue. Cluster analysis was performed using euclidean distance measure (average), data was transformed using Hellinger transformation.
Figure A.11: Hierarchical cluster analysis of bacterial communities from wildlife samples, separated by sample types. (A) Blood, (B) Tick, (C) Tissue. Data points coloured by host species (and tick species (B)). Cluster analysis was performed using euclidean distance measure (average), data was transformed using Hellinger transformation.
A.2.1 Statistical analysis
Beta diversity statistical analysis of bacterial microbiome composition using analysis of variance (ANOVA) and permutational multivariate analysis of variance (PERMANOVA) methods. Statistical analysis calculated using the vegan R package. Data cleaning and transformation: removed samples with < 1000 sequences, transformed data using Hellinger transformation method. Distance calculated using Bray-Curtis distance measure.
A.2.1.1 Sample Type
Statistical analysis comparing the bacterial microbiome of blood, tick and tissue samples collected form wildlife.
A. Analysis of Variance (ANOVA)
Analysis of Variance Table
Response: Distances
Df Sum Sq Mean Sq F value Pr(>F)
Groups 2 0.4466 0.223289 36.209 1.364e-15 ***
Residuals 614 3.7863 0.006167
---
Signif. codes: 0 ‘***’ 0.001 ‘**’ 0.01 ‘*’ 0.05 ‘.’ 0.1 ‘ ’ 1B. Permutational multivariate analysis of variance (PERMANOVA)
Permutation test for homogeneity of multivariate dispersions
Permutation: free
Number of permutations: 999
Response: Distances
Df Sum Sq Mean Sq F N.Perm Pr(>F)
Groups 2 0.4466 0.223289 36.209 999 0.001 ***
Residuals 614 3.7863 0.006167
---
Signif. codes: 0 ‘***’ 0.001 ‘**’ 0.01 ‘*’ 0.05 ‘.’ 0.1 ‘ ’ 1
Pairwise comparisons:
(Observed p-value below diagonal, permuted p-value above diagonal)
Blood Tick Tissue
Blood 4.1600e-01 0.001
Tick 4.0839e-01 0.001
Tissue 8.8347e-17 3.5464e-15 A.2.1.2 Tick species
Statistical analysis comparing bacterial microbiome of tick collected from wildlife (all tick species).
A. Analysis of Variance (ANOVA)
Analysis of Variance Table
Response: Distances
Df Sum Sq Mean Sq F value Pr(>F)
Groups 6 2.5929 0.43215 14.01 9.594e-14 ***
Residuals 251 7.7423 0.03085 B. Permutational multivariate analysis of variance (PERMANOVA)
Permutation test for homogeneity of multivariate dispersions
Permutation: free
Number of permutations: 999
Response: Distances
Df Sum Sq Mean Sq F N.Perm Pr(>F)
Groups 6 2.5929 0.43215 14.01 999 0.001 ***
Residuals 251 7.7423 0.03085
---
Signif. codes: 0 ‘***’ 0.001 ‘**’ 0.01 ‘*’ 0.05 ‘.’ 0.1 ‘ ’ 1
Pairwise comparisons:
(Observed p-value below diagonal, permuted p-value above diagonal)
Amtri Ixant Ixaus Ixhol Ixhol;Ixtri Ixtas Ixtri
Amtri 9.4400e-01 3.6500e-01 2.5700e-01 7.8500e-01 0.001
Ixant
Ixaus 9.3797e-01 5.9300e-01 3.8000e-02 7.3300e-01 0.001
Ixhol 3.4424e-01 5.7323e-01 5.3700e-01 1.0000e-03 0.001
Ixhol;Ixtri 2.4249e-01 4.5601e-02 5.3705e-01 3.8000e-02 0.001
Ixtas 7.8073e-01 7.4761e-01 3.5985e-05 3.8405e-02 0.001
Ixtri 1.0858e-06 4.6854e-09 2.0461e-06 1.2151e-05 5.1524e-15 Statistical analysis comparing bacterial microbiome of cohabiting tick species collected from wildlife in Sydney Northern Beaches area, New South Wales (Ix. holocyclus, Ix. tasmani, and Ix. trichosuri).
A. Analysis of Variance (ANOVA)
Analysis of Variance Table
Response: Distances
Df Sum Sq Mean Sq F value Pr(>F)
Groups 3 2.3202 0.77341 25.465 2.177e-14 ***
Residuals 247 7.5019 0.03037
---
Signif. codes: 0 ‘***’ 0.001 ‘**’ 0.01 ‘*’ 0.05 ‘.’ 0.1 ‘ ’ 1B. Permutational multivariate analysis of variance (PERMANOVA)
Permutation test for homogeneity of multivariate dispersions
Permutation: free
Number of permutations: 999
Response: Distances
Df Sum Sq Mean Sq F N.Perm Pr(>F)
Groups 3 2.3202 0.77341 25.465 999 0.001 ***
Residuals 247 7.5019 0.03037
---
Signif. codes: 0 ‘***’ 0.001 ‘**’ 0.01 ‘*’ 0.05 ‘.’ 0.1 ‘ ’ 1
Pairwise comparisons:
(Observed p-value below diagonal, permuted p-value above diagonal)
Ixhol Ixhol;Ixtri Ixtas Ixtri
Ixhol 5.3000e-01 1.0000e-03 0.001
Ixhol;Ixtri 5.3687e-01 3.9000e-02 0.001
Ixtas 3.5862e-05 3.8383e-02 0.001
Ixtri 2.0485e-06 1.2237e-05 5.1829e-15 A.2.2 Supplementary Electronic Tables
The following electronic supplementary files are available for download on FigShare, repository doi: 10.6084/m9.figshare.14363627.
A.2.2.1 Supplementary table E1.1
Supplementary table E1.1: Detail for taxa of interest with sequence information and sample metadata, including results from NCBI BLAST analysis. Taxa of interest sample data and BLAST results
A.2.2.2 Supplementary table E1.2
Supplementary table E1.2: Genetic similarity of Anaplasmataceae sequences based on a 1,244 bp alignment of the 16S rRNA gene. Sequences generated from the present study in bold. Bottom half of matrix showing sequence similarity and top half containing genetic distance data. Anaplasmataceae genetic diversity table
A.2.2.3 Supplementary table E1.3
Supplementary table E1.3: Genetic similarity of Borrelia sequences based on a 431 bp alignment of the 16S rRNA gene. Sequences generated from the present study in bold. Bottom half of matrix showing sequence similarity and top half containing genetic distance data. Borrelia genetic diversity table
A.2.2.4 Supplementary table E1.4
Supplementary table E1.4: Genetic similarity of Bartonella sequences based on a 522 bp alignment of the 16S rRNA-ITS gene. Sequences generated from the present study in bold. Bottom half of matrix showing sequence similarity and top half containing genetic distance data. Bartonella genetic diversity table
A.3 Chapter 4
Supplementary material for Chapter 4 on Haemoprotozoa Surveillance.
Figure A.12: Summary of sequences obtained from trypanosome metabatcoding of the 18S rRNA gene. (A) Library size (i.e. number of sequences) obtained from samples. (B) Distribution of the number of reads in sample categories blood, tick and tissue.
A.3.1 Supplementary Electronic Tables
The following electronic supplementary files are available for download on FigShare, repository doi: 10.6084/m9.figshare.14370965.
A.3.1.1 Supplementary table E2.1
Supplementary table E2.1: Trypanosoma amplicon sequence data from blood, tick and tissue samples. Data showing zOTUs belonging to the Trypanosomatidae family with results from NCBI BLAST analysis. Trypanosome zOTU taxonomy and sample data
A.3.1.2 Supplementary table E2.2
Supplementary table E2.2: Genetic similarity of piroplasm sequences based on an 852 bp alignment of the 18S rRNA gene. Sequences generated from the present study in bold. Bottom half of matrix showing sequence similarity and top half containing genetic distance data. Piroplasm genetic diversity table
A.3.1.3 Supplementary table E2.3
Supplementary table E2.3: Genetic similarity of Hepatozoon sequences based on an 819 bp alignment of the 18S rRNA gene. Sequences generated from the present study in bold. Bottom half of matrix showing sequence similarity and top half containing genetic distance data. Hepatozoon genetic diversity table
A.4 Chapter 6
Supplementary material for Chapter 6 on Tasmanian Devil Haemoprotozoa.
| Species | Isolate | Host Scientific | Location (a) | 18S rRNA | gGAPDH |
|---|---|---|---|---|---|
| Tr. copemani | JD-2008a Mika | Koala (Phascolarctos cinereus) | AU (NSW) |
|
GU966585 |
| Tr. copemani | JD-2008a Charlton | Koala (Phascolarctos cinereus) | AU (QLD) | GU966588 |
|
| Tr. copemani | TD-BRI115 | Tasmanian devil (Sarcophilus harrisii) | AU (TAS) | MT883297 | MT514664 |
| Tr. copemani | H26 | Wombat (Vombatus ursinus) | AU (VIC) | AJ009169 | |
| Tr. copemani | G1 | Woylie (Bettongia penicillata) | AU (WA) | KC753530 | KC812982 |
| Tr. copemani | APP | Wombat (Vombatus ursinus) | AU (VIC) | AJ620558 | AJ620277 |
| Tr. copemani | G2 | Woylie (Bettongia penicillata) | AU (WA) | KC753531 | KC812983 |
| Tr. copemani | Q2088 | Quokka (Setonix brachyurus) | AU (WA) | HQ267094 | HQ267095 |
| Tr. vegrandis | G4 | Woylie (Bettongia penicillata) | AU (WA) | KC753532 | KC812985 |
| Tr. vegrandis | G7 | Woylie (Bettongia penicillata) | AU (WA) | KC753536 | KC812987 |
| Tr. vegrandis | G5 | Woylie (Bettongia penicillata) | AU (WA) | KC753534 | KC812986 |
| Tr. vegrandis | G3 | Woylie (Bettongia penicillata) | AU (WA) | KC753533 | KC812984 |
| Tr. vegrandis | G6 | Woylie (Bettongia penicillata) | AU (WA) | KC753535 |
|
| Tr. gilletti | Lanie | Koala (Phascolarctos cinereus) | AU (QLD) | GU966589 | GU966587 |
| Tr. cruzi | G | Opossum (Didelphis marsupialis) | BR | AF239981 | GQ140351 |
| Tr. cruzi marinkellei | TryCC 344 | Bat (Carollia perspicillata) | BR | FJ001664 | GQ140360 |
| Tr. erneyi | TCC1294 | Bat (Tadarida sp.) | MZ | JN040988 | JN040965 |
| Tr. dionisii | TryCC 211 | Bat (Eptesicus brasiliensis) | BR | FJ001666 | GQ140362 |
| Tr. rangeli | AM80 | Human (Homo sapiens) | BR | AY491766 | JN040973 |
| Tr. noyesi | H25 | Kangaroo (Macropus giganteus) | AU (VIC) | AJ009168 | AJ620276 |
| Tr. noyesi | WC6218 | Woylie (Bettongia penicillata) | AU (WA) | KU354263 | KU354264 |
| Tr. livingstonei | TCC1270 | Bat (Rhinolophus landeri) | MZ | KF192979 | KF192958 |
| Tr. lewisi | Molteno B3 | Rat (Rattus sp.) | UK | AJ009156 | AJ629272 |
| Tr. microti | TRL132 | Vole (Microtis agrestis) | UK | AJ009158 | AJ620273 |
| Tr. sp. | TD-WPP601 (genotype A) | Tasmanian devil (Sarcophilus harrisii) | AU (TAS) | MT883326 | MT514665 |
| Tr. sp. | TD-WPP602 (genotype A) | Tasmanian devil (Sarcophilus harrisii) | AU (TAS) |
|
MT514666 |
| Tr. sp. | TD-WPP585 (genotype A) | Tasmanian devil (Sarcophilus harrisii) | AU (TAS) | MT883324 |
|
| Tr. sp. | TD-BRI111 (genotype B) | Tasmanian devil (Sarcophilus harrisii) | AU (TAS) | MT883296 |
|
| Tr. sp. | TD-TKN211 (genotype B) | Tasmanian devil (Sarcophilus harrisii) | AU (TAS) | MT883322 |
|
| Tr. sp. | ABF (wallaby) | Swamp wallaby (Wallabia bicolor) | AU (VIC) | AJ620564 | AJ620278 |
| Tr. cyclops | LV492 | Macaque (Macaca sp.) | MY | AJ131958 | FJ649493 |
| Tr. sp. | TL.AQ.22 | Leech(Philaemon) | AU (QLD) | AJ620574 | AJ620280 |
| Tr. sp. | TL.AQ.45 | Leech(Philaemon) | AU (QLD) | AJ620575 |
|
| Tr. sp. | TL.AV.44. cl157 | Leech (Micobdella) | AU (VIC) | AJ620573 |
|
| Tr. sp. | TL.AV.44 cl. 156B | Leech (Micobdella) | AU (VIC) | AJ620572 |
|
| Tr. sp. | TL.AV.43 cl100B | Leech (Micobdella) | AU (VIC) | AJ620570 |
|
| Tr. sp. | TL.AV.43 cl.101E | Leech (Micobdella) | AU (VIC) | AJ620571 |
|
| Tr. sp. | TL.AQ.40 | Leech(Philaemon) | AU (QLD) | AJ620576(b) |
|
| Tr. sp. | TL.AQ.48 | Leech(Philaemon) | AU (QLD) | AJ620577(b) |
|
| Tr. sp. | Frog ADE | Frog (Mixophyes flaeyi) | AU (VIC) | AJ620569(b) |
|
| Tr. sp. | TL.SL.1 | Leech (Haemadipsa zeylanica) | SL | AJ620578(b) |
|
| Tr. sp. | Wallaby 10 | Brush-tailed rock-wallaby (Petrogale penicillate) | AU (VIC) | AJ620563(b) |
|
| Tr. sp. | TL.NG.1 | Leech (Leiobdella jawarerensis) | PNG | AJ620581(b) |
|
| Tr. theileri | K127 | Cattle (Bos taurus) | DE | AJ009164 | AJ620282 |
| Tr. theileri | KM | Cattle (Bos taurus) | JP | AB007814(b) |
|
| Tr. theileri | Bb756 | European bison(Bison bonasus) | PL | KF765801(b) |
|
| Tr. theileri | Tthc26 | Cattle (Bos sp.) | BR | GQ176153(b) |
|
| Tr. irwini | Koala (Phascolarctos cinereus) | AU (QLD, NSW) | FJ649479 | FJ649485 | |
| Tr. bennetti | KT-2 | Kestrel (Falco sparverius) | US | AJ223562 | FJ649486 |
| Tr. sp. | ATT | Currawong (Strepera sp.) | AU (VIC) | AJ620557 | AJ620264 |
| Tr. mega | ATCC 30038 | Toad (Bufo regularis) | Africa | AJ009157 | AJ620253 |
| Tr. rotatorium | B2-II | Bullfrog (Rana catesbeiana) | CA | AJ009161 | AJ620256 |
| Tr. binneyi | AWW | Platypus (Ornithorhynchus anatinus) | AU (VIC) | AJ620565 | AJ620266 |
| Tr. granulosum | UK | Eel (Anguilla anguilla) | PT | AJ620551 |
|
| Phytomonas serpens | N/A | N/A | N/A | U39577 | EU084892 |
| Herpetomonas muscarum | N/A | N/A | N/A | L18872 | DQ092548 |
| a Country abbreviations: AU - Australia, MZ - Mozambique, UK - United Kingdom, MY - Malaysia, SL - Sri Lanka, PNG - Papua New Guinea, DE - Germany, JP- Japan, PL- Poland, BR - Brazil, CA- Canada, PT - Portugal, US - United States of America. Australian states: QLD - Queensland, TAS - Tasmania, WA - Western Australia. | |||||
| b Short sequences of the 18S rRNA gene only, included for comparison within the Trypanosoma cyclops clade. |
| Genotype | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | T. theileri KM AB007814 | |||||||||||||||||||||
| 2 | T. theileri Bb756 KF765801 | 100.0 | ||||||||||||||||||||
| 3 | T. theileri K127 AJ009164 | 97.5 | 97.5 | |||||||||||||||||||
| 4 | T. theileri Tthc26 GQ176153 | 97.2 | 97.2 | 99.8 | ||||||||||||||||||
| 5 | T. sp. TL.AQ.40 AJ620576 | 87.3 | 87.3 | 87.2 | 87.5 | |||||||||||||||||
| 6 | T. sp. TL.AQ.48 AJ620577 | 87.3 | 87.3 | 87.2 | 87.5 | 99.8 | ||||||||||||||||
| 7 | T. sp. Frog ADE AJ620569 | 87.4 | 87.4 | 87.3 | 87.5 | 95.3 | 95.1 | |||||||||||||||
| 8 | T. cyclops LV492 AJ131958 | 82.2 | 82.2 | 82.2 | 82.4 | 89.6 | 89.3 | 88.1 | ||||||||||||||
| 9 | T. sp. TL.AQ.45 AJ620575 | 88.2 | 88.2 | 88.2 | 88.4 | 97.2 | 97.0 | 98.1 | 89.8 | |||||||||||||
| 10 | WPP585 MT883324 | 82.0 | 82.0 | 82.0 | 82.2 | 90.7 | 90.4 | 89.4 | 97.4 | 91.1 | ||||||||||||
| 11 | WPP601 MT883326 | 82.0 | 82.0 | 82.0 | 82.2 | 90.7 | 90.4 | 89.4 | 97.4 | 91.1 | 100.0 | |||||||||||
| 12 | BRI111 MT883296 | 87.0 | 87.0 | 87.0 | 87.2 | 96.9 | 96.7 | 97.0 | 89.5 | 98.4 | 90.9 | 90.9 | ||||||||||
| 13 | T. sp. TL.AQ.22 AJ620574 | 82.0 | 82.0 | 82.0 | 82.2 | 89.8 | 89.6 | 88.8 | 97.2 | 90.5 | 98.5 | 98.5 | 90.2 | |||||||||
| 14 | T. sp. TL.AV.44 cl157 AJ620573 | 87.2 | 87.2 | 87.1 | 87.4 | 95.6 | 95.4 | 98.4 | 88.8 | 98.4 | 89.7 | 89.7 | 97.2 | 89.1 | ||||||||
| 15 | T. sp. TL.SL.1 AJ620578 | 86.8 | 86.8 | 86.7 | 86.9 | 95.4 | 95.2 | 98.1 | 88.2 | 98.1 | 89.5 | 89.5 | 97.0 | 88.9 | 99.3 | |||||||
| 16 | T. sp. ABF AJ620564 | 87.5 | 87.5 | 87.5 | 87.7 | 97.7 | 97.4 | 97.4 | 90.4 | 98.8 | 90.9 | 90.9 | 98.1 | 90.7 | 97.2 | 97.0 | ||||||
| 17 | T. sp. TL.AV.44 cl158b AJ620572 | 87.1 | 87.1 | 87.0 | 87.2 | 95.4 | 95.2 | 97.2 | 88.3 | 98.2 | 89.6 | 89.6 | 96.5 | 89.0 | 98.4 | 98.2 | 97.0 | |||||
| 18 | T. sp. TL.AV.43 cl100b AJ620570 | 88.2 | 88.2 | 88.2 | 88.4 | 95.6 | 95.3 | 96.7 | 88.7 | 98.4 | 89.6 | 89.6 | 96.7 | 89.0 | 97.4 | 96.8 | 97.2 | 97.0 | ||||
| 19 | T. sp. TL.AV.43 cl100e AJ620571 | 88.7 | 88.7 | 88.6 | 88.8 | 96.3 | 96.0 | 97.4 | 89.0 | 99.1 | 90.3 | 90.3 | 97.4 | 89.7 | 97.7 | 97.5 | 97.9 | 97.7 | 99.3 | |||
| 20 | T. sp. wallaby 10 AJ620563 | 88.4 | 88.4 | 88.4 | 88.6 | 96.0 | 95.8 | 97.2 | 88.7 | 98.8 | 90.0 | 90.0 | 97.2 | 89.4 | 97.4 | 97.2 | 97.7 | 97.5 | 99.1 | 99.8 | ||
| 21 | T. sp. TL.NG.1 AJ620581 | 90.5 | 90.5 | 90.0 | 90.0 | 96.0 | 95.7 | 96.8 | 87.5 | 98.7 | 88.7 | 88.7 | 96.8 | 88.0 | 97.1 | 96.8 | 97.6 | 97.4 | 98.9 | 99.7 | 100 |